WormMine: Gene WBGene00072597

• WormBase Gene ID: WBGene00072597
• Gene Name: Cre-sdpn-1
• Sequence Name: CRE00004
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Fes/CIP4, and EFC/F-BAR homology domain; FCH domain; SH3-like domain superfamily; SH3 domain; and AH/BAR domain superfamily. Is an ortholog of C. elegans sdpn-1. In C. elegans, sdpn-1 is involved in endocytic recycling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00004.1	CRE00004.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00004	CRE00004		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115949
• Remark: Cre-sdpn-1, GAAGGGGATGAGATTGCGTTAAGGAAAGGAGAGACGATAGAAGTTCTTACTGAGCCTGAT, WBGene00072597
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term