WormMine: Gene WBGene00179670

• WormBase Gene ID: WBGene00179670
• Gene Name: Cjp-nhr-107
• Sequence Name: CJA24098
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Nuclear hormone receptor-like domain superfamily; Nuclear hormone receptor family member nhr-150; Ligand-binding domain of nuclear hormone receptor; and Nuclear hormone receptor, ligand-binding domain. Is an ortholog of C. elegans nhr-107.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA24098.1	CJA24098.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA24098	CJA24098		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084187
• Remark: CJA24098, GTATGCAAATGTTAGCGAGCAGCTGGCGGAGGTGTGTCGTGCGATGCGAAACATTATGTT, WBGene00179670
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term