WormMine: Gene WBGene00035852

• WormBase Gene ID: WBGene00035852
• Gene Name: Cbr-gei-4
• Sequence Name: CBG15706
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans gei-4. In C. elegans, gei-4 is involved in negative regulation of Ras protein signal transduction and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15706b.1	CBG15706b.1		[unknown]
Transcript:CBG15706a.1	CBG15706a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15706a	CBG15706a		[unknown]
CDS:CBG15706b	CBG15706b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064552
• Remark: Cbr-gei-4, ATACCATCGAATGAACGACGAGGAGAAGCGCATCTACAATCAGCGACGCACTGAAGCATT, WBGene00035852
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term