WormMine: Gene WBGene00075891

• WormBase Gene ID: WBGene00075891
• Gene Name: Cre-mec-15
• Sequence Name: CRE26848
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: F-box-like; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; F-box-like domain superfamily; F-box domain; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans mec-15. In C. elegans, mec-15 is involved in several processes, including positive regulation of GABAergic synaptic transmission; positive regulation of multicellular organismal process; and response to mechanical stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26848.1	CRE26848.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26848	CRE26848		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107919
• Remark: CRE26848, GCGAAAGATGAGACCGCGCATCTCGGATGGATTTGGAATATGGCGAGAGATTCAGAATCC, WBGene00075891
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term