WormMine: Gene WBGene00075361

• WormBase Gene ID: WBGene00075361
• Gene Name: CRE12433
• Sequence Name: CRE12433
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Sru and 7TM GPCR, serpentine receptor class u (Sru). Is an ortholog of C. elegans sru-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12433.1	CRE12433.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12433	CRE12433		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093288
• Remark: CRE12433, CTTGTGTTGTTCCGTGGATATTCTATTTGACTCATCCGGTATTCAAGAAGAAAGCAATCA, WBGene00075361
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term