WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00078748 Gene Name  CRE04639
Sequence Name  ? CRE04639 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Protein Lsm12-like and Anticodon-binding domain. Is an ortholog of C. elegans M142.5. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE04639a.1 CRE04639a.1   [unknown]
Transcript:CRE04639b.1 CRE04639b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE04639b CRE04639b   [unknown]
CDS:CRE04639a CRE04639a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE04639, AAAAAGATACTTTCCAAACCTGCAACCGGCTACACATCACGAGCTCCACTCGATTTCACT, WBGene00078748   Expr1096894 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term