WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026512 Gene Name  Cbr-lin-53
Sequence Name  ? CBG03710 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; Histone-binding protein RBBP4, N-terminal; WD40/YVTN repeat-like-containing domain superfamily; Histone-binding protein RBBP4 or subunit C of CAF1 complex; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans lin-53. In C. elegans, lin-53 is involved in several processes, including cell fate specification; embryonic digestive tract morphogenesis; and nematode male tail tip morphogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03710.1 CBG03710.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03710 CBG03710   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_downregulated
  C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lin-53, GAATTCATACTAGCCACTGGTTCAGCCGATAAAACTGTCGCGCTTTGGGATCTCAGGAAT, WBGene00026512   Expr1053107 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term