WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00206701 Gene Name  Cjp-sel-1.3
Sequence Name  ? CJA30854 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Sel1 repeat; Tetratricopeptide-like helical domain superfamily; and Sel1-like repeat. Is an ortholog of C. elegans sel-1. In C. elegans, sel-1 is involved in negative regulation of Notch signaling pathway. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA30854.1 CJA30854.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA30854 CJA30854   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-sel-1, TATACCTGGCCAAACGATTTTACGATCAAGCGATTGAGCACAGTCAGGACGCATTTATGC, WBGene00135772   Expr1085791 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA18340, AAATATTTGTTTATGGCCGAGTTGGGGTACGAAGTGGCGCAAACGAATCTGGCGTATATT, WBGene00137543   Expr1076382 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term