WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00079289 Gene Name  Cre-bath-31.1
Sequence Name  ? CRE06630 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: MATH domain; MATH/TRAF domain; BTB/POZ domain; TRAF-like; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans bath-31. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE06630.1 CRE06630.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE06630 CRE06630   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE06630, GGAATCGATGCGGATGACTTTCAGAACTATCTGGAATTGCTTTACGGAGACAATCCAATT, WBGene00079289   Expr1109321 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term