WormMine: Gene WBGene00037017

• WormBase Gene ID: WBGene00037017
• Gene Name: Cbr-vhl-1
• Sequence Name: CBG17370
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: VHL superfamily; VHL beta domain; von Hippel-Lindau disease tumour suppressor, beta domain superfamily; and von Hippel-Lindau disease tumour suppressor, beta domain. Is an ortholog of C. elegans vhl-1. In C. elegans, vhl-1 is involved in response to hypoxia.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17370.1	CBG17370.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17370	CBG17370		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065007
• Remark: Cbr-vhl-1, GAGAAGCGAGAGTACAACGAATTCAACTGCCGAGACTTTCAGCCTCCTCCACAAGCATAA, WBGene00037017
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term