WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00178408 Gene Name  CJA22836
Sequence Name  ? CJA22836 Organism  Caenorhabditis japonica
Biotype  SO:0001217 Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA22836.1 CJA22836.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA22836 CJA22836   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA27334, AAGCGATCTTTTGCCCAACTGGTCAACACAGCAATCACGCCTCACACCTGTCGTCTCTGC, WBGene00182906   Expr1084867 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22836, GCGCGCCCAAGCGATCTTTTGCCCAACTGGTCAACACAGCAATCACGCCTCACACCTGTC, WBGene00178408   Expr1088259 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA20809, GGAGCTGCTATAAAAGGAGGACAATCGAACCATTCGGGAGCGGTTTGCGTAACCACACAT, WBGene00176381   Expr1079024 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term