WormMine: Gene WBGene00033867

• WormBase Gene ID: WBGene00033867
• Gene Name: Cbr-lin-26
• Sequence Name: CBG13032
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans lin-26. In C. elegans, lin-26 is involved in several processes, including positive regulation of transcription by RNA polymerase II; tissue development; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13032.1	CBG13032.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13032	CBG13032		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051514
• Remark: Cbr-lin-26, GTGCTAAAGAGCGTGGATGGCAACCAGAGGAGTCTCTTGAGAAAAAGGCAGAGGAGGAGG, WBGene00033867
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term