WormMine: Gene WBGene00036597

• WormBase Gene ID: WBGene00036597
• Gene Name: Cbr-unc-98
• Sequence Name: CBG16732
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger C2H2-type; C2H2-type zinc finger; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans unc-98. In C. elegans, unc-98 is involved in several processes, including locomotory behavior; myofibril assembly; and post-embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16732.1	CBG16732.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16732	CBG16732		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054358
• Remark: Cbr-unc-98, CGGACAGTCGAGGATTGGCCTATCACATGTACAGTCATCGTGGAGAGAAGCAATTCAATC, WBGene00036597
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term