WormMine: Gene WBGene00039437

• WormBase Gene ID: WBGene00039437
• Gene Name: Cbr-crml-1
• Sequence Name: CBG20460
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine Rich repeat; CARMIL, pleckstrin homology domain; Leucine-rich repeat; Carmil pleckstrin homology domain; Leucine-rich repeat domain superfamily; and PH-like domain superfamily. Is an ortholog of C. elegans crml-1. In C. elegans, crml-1 is involved in several processes, including axon guidance; negative regulation of Rac protein signal transduction; and regulation of axon extension involved in axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20460.1	CBG20460.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20460	CBG20460		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054341
• Remark: Cbr-crml-1, GACAGCCGAAGATGATGAGAATGCGAATAGTCGGCGATCGGTAGCTGATATGGCGAAAAT, WBGene00039437
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term