WormMine: Gene WBGene00033894

• WormBase Gene ID: WBGene00033894
• Gene Name: Cbr-farl-11
• Sequence Name: CBG13065
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: N1221-like protein; Domain of unknown function (DUF3402); Far11/STRP; Far11/STRP, C-terminal; and Far11/STRP, N-terminal. Is an ortholog of C. elegans farl-11. In C. elegans, farl-11 is involved in endoplasmic reticulum organization; epithelial tube morphogenesis; and positive regulation of endocytic recycling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13065.1	CBG13065.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13065	CBG13065		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059464
• Remark: CBG13065, CAACCAGTGGACACCTGTGCGCATTCAGTTCTTGGAGAAAACATCGAACTTGGATTCAAA, WBGene00033894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term