WormMine: Gene WBGene00028287

• WormBase Gene ID: WBGene00028287
• Gene Name: Cbr-hmg-5
• Sequence Name: CBG05930
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: High mobility group box domain; High mobility group box domain superfamily; HMG-box domain; and HMG (high mobility group) box. Is an ortholog of C. elegans hmg-5. In C. elegans, hmg-5 is involved in mitochondrial DNA metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05930.1	CBG05930.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05930	CBG05930		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062602
• Remark: Cbr-hmg-5, CTGAAGGACGAGTACCACAATACTCTCGCCATTTGGGCAAGTGAGAAGAAGGAGAAATCC, WBGene00028287
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term