WormMine: Gene WBGene00033375

• WormBase Gene ID: WBGene00033375
• Gene Name: Cbr-tax-2
• Sequence Name: CBG12422
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cyclic nucleotide-binding domain; RmlC-like jelly roll fold; and Cyclic nucleotide-binding-like. Is an ortholog of C. elegans tax-2. In C. elegans, tax-2 is involved in several processes, including G protein-coupled receptor signaling pathway coupled to cGMP nucleotide second messenger; positive regulation of macromolecule biosynthetic process; and thermosensory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12422.1	CBG12422.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12422	CBG12422		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067050
• Remark: Cbr-tax-2, TCGGAGGAAACAACAGGAGAACCGCATCAATTAGAGCCAAAGGATACTGTACTTTGTTCG, WBGene00033375
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term