WormMine: Gene WBGene00037463

• WormBase Gene ID: WBGene00037463
• Gene Name: CBG17962
• Sequence Name: CBG17962
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is an ortholog of C. elegans C35D10.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17962c.1	CBG17962c.1		[unknown]
Transcript:CBG17962b.1	CBG17962b.1		[unknown]
Transcript:CBG17962a.1	CBG17962a.1		[unknown]
Transcript:CBG17962a.2	CBG17962a.2		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17962b	CBG17962b		[unknown]
CDS:CBG17962a	CBG17962a		[unknown]
CDS:CBG17962c	CBG17962c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1066541
• Remark: CBG17962, GATGCGAATCGAGTTTGATCAAACCACGTCACCATCTTCATCGCCCAGTAGATCTGACAA, WBGene00037463
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term