WormMine: Gene WBGene00209778

• WormBase Gene ID: WBGene00209778
• Gene Name: CJA33931
• Sequence Name: CJA33931
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF1096 and Protein of unknown function (DUF1096). Is an ortholog of members of the C. elegans pqn and abu gene classes including pqn-79 and abu-5. In C. elegans, abu-4 is involved in endoplasmic reticulum unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33931.1	CJA33931.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33931	CJA33931		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071813
• Remark: CJA02176, AAACAATGCGTGCAACAACAGCAGCCAATTCAACAGTGCGCCCCAGCCTGTACTCAGACG, WBGene00121380
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term