WormMine: Gene WBGene00209234

• WormBase Gene ID: WBGene00209234
• Gene Name: Cjp-cutl-18
• Sequence Name: CJA33387
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zona pellucida-like domain; PAN/Apple domain; Zona pellucida domain; and PAN domain. Is an ortholog of C. elegans cutl-18.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33387a.1	CJA33387a.1		[unknown]
Transcript:CJA33387b.1	CJA33387b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33387b	CJA33387b		[unknown]
CDS:CJA33387a	CJA33387a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078661
• Remark: Cjp-cutl-18, CGATTTTAATATCATCTCAATTAATTGTGCTCATTTATCTGTGCCTGAAAAGTCGAAAGT, WBGene00132325
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term