WormMine: Gene WBGene00030459

• WormBase Gene ID: WBGene00030459
• Gene Name: CBG08714
• Sequence Name: CBG08714
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RWD domain; Ubiquitin-conjugating enzyme/RWD-like; GIR2-like; DRG Family Regulatory Proteins, Tma46; and ZC3H15/TMA46 family, C-terminal. Is an ortholog of C. elegans T26E3.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08714.1	CBG08714.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08714	CBG08714		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060678
• Remark: CBG08714, CGAAGATGTATTCAGCGAGGAGCGGATTTCTGAATCTATTCAAAAGCTACGAGCCGTTGC, WBGene00030459
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term