WormMine: Gene WBGene00028316

• WormBase Gene ID: WBGene00028316
• Gene Name: Cbr-lgg-2
• Sequence Name: CBG05962
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Autophagy protein Atg8 ubiquitin-like; and Autophagy protein Atg8 ubiquitin like. Is an ortholog of C. elegans lgg-2. In C. elegans, lgg-2 is involved in cellular response to toxic substance; defense response to other organism; and positive regulation of autophagosome maturation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05962.1	CBG05962.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05962	CBG05962		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059383
• Remark: Cbr-lgg-2, CAACTCAATGAGCATGTCCAACTTGTACGGTCAAGAGCGTGATCCAGACGGCTTTGTATA, WBGene00028316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term