WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035525 Gene Name  CBG15203
Sequence Name  ? CBG15203 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat and Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans mat-3. In C. elegans, mat-3 is involved in asymmetric cell division; polarity specification of anterior/posterior axis; and positive regulation of metaphase/anaphase transition of meiosis I. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15203.1 CBG15203.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15203 CBG15203   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15202, CCAGTGAGTACATGCGACGTGCTAGAAAAATCGACTCGGCTTCGAAAACGCCAACCAGAA, WBGene00035524   Expr1055759 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG15203, GTATTCTCTGTATTACTATCAAGAGGCTCAGAAATGCAAACCACACGATTCTCGACTCCT, WBGene00035525   Expr1061660 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term