WormMine: Gene WBGene00039522

• WormBase Gene ID: WBGene00039522
• Gene Name: Cbr-memo-1
• Sequence Name: CBG20564
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MEMO1 family and Memo-like protein. Is an ortholog of C. elegans memo-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20564a.2	CBG20564a.2		[unknown]
Transcript:CBG20564a.3	CBG20564a.3		[unknown]
Transcript:CBG20564a.4	CBG20564a.4		[unknown]
Transcript:CBG20564a.1	CBG20564a.1		[unknown]
Transcript:CBG20564b.1	CBG20564b.1		[unknown]
Transcript:CBG20564c.1	CBG20564c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20564a	CBG20564a		[unknown]
CDS:CBG20564b	CBG20564b		[unknown]
CDS:CBG20564c	CBG20564c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065524
• Remark: Cbr-tag-253, CAAAACACAATCTGCGGACGGAATCCGATTCTCATCATGCTGCAGGCAGCAGAAGGCTTC, WBGene00039522
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term