WormMine: Gene WBGene00039508

• WormBase Gene ID: WBGene00039508
• Gene Name: Cbr-tam-1
• Sequence Name: CBG20546
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RING-type zinc-finger, LisH dimerisation motif; Zinc finger, RING-type; and RING-type zinc-finger. Is an ortholog of C. elegans tam-1. In C. elegans, tam-1 is involved in chromosome segregation; negative regulation of vulval development; and transcription initiation-coupled chromatin remodeling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20546b.1	CBG20546b.1		[unknown]
Transcript:CBG20546c.1	CBG20546c.1		[unknown]
Transcript:CBG20546a.1	CBG20546a.1		[unknown]
Transcript:CBG20546d.1	CBG20546d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20546a	CBG20546a		[unknown]
CDS:CBG20546b	CBG20546b		[unknown]
CDS:CBG20546c	CBG20546c		[unknown]
CDS:CBG20546d	CBG20546d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067513
• Remark: Cbr-tam-1, TGGTGGAAAAGAAGGCGTTGACTTCAGATGACGTTCGGCAGATGAAGCAGAAGATCAACG, WBGene00039508
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term