WormMine: Gene WBGene00081787

• WormBase Gene ID: WBGene00081787
• Gene Name: CRE27881
• Sequence Name: CRE27881
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Mitochondrial substrate/solute carrier; Mitochondrial carrier domain superfamily; and Mitochondrial carrier protein. Is an ortholog of C. elegans F01G4.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27881.1	CRE27881.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27881	CRE27881		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1099972
• Remark: CRE27881, GTCAATCCAGAAAAGTATACTGGTACCGCCTTTGGATTACGCACCACTGTTGCTGAGGAG, WBGene00081787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term