WormMine: Gene WBGene00080826

• WormBase Gene ID: WBGene00080826
• Gene Name: CRE08812
• Sequence Name: CRE08812
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; RING-type zinc-finger, LisH dimerisation motif; Zinc finger, RING-type; and RING-type zinc-finger. Is an ortholog of C. elegans F53F8.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE08812.1	CRE08812.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE08812	CRE08812		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097539
• Remark: CRE08812, ATATGACTACTTGGCGTGTCCATTCGATCGGATTATAATTCATCTTGATGAAATTCCAAT, WBGene00080826
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term