WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00080118 Gene Name  CRE29010
Sequence Name  ? CRE29010 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: NTF2-like domain superfamily; Domain of unknown function (DUF4440); and Domain of unknown function DUF4440. Is an ortholog of C. elegans R09E12.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29010.1 CRE29010.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29010 CRE29010   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE29012, TGGAAGAAGGAGGGAGATAGACACTTGGTTTTCCATGATGAATTCGAAATTACTGCTTAG, WBGene00080110   Expr1113032 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE16368, TGTCGTAGAGGGATTCTACCATCCAAATGGAGTTTTGGTTCACAAGGATAAGGAATGCAC, WBGene00081427   Expr1116413 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term