WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024877 Gene Name  Cbr-rpl-7A
Sequence Name  ? CBG01675 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal protein L7Ae/L8/Nhp2 family; Ribosomal protein L7Ae/L30e/S12e/Gadd45 family; Ribosomal protein L7A/L8; 50S ribosomal protein L30e-like; and Ribosomal protein L7Ae/L30e/S12e/Gadd45. Is an ortholog of C. elegans rpl-7A. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01675.1 CBG01675.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01675 CBG01675   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-rpl-7A, GACAAGACATCCAGCCAAAGAGAGATGTTACCCGCTTCGTCAAGTGGCCTAAATACATCC, WBGene00024877   Expr1067822 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term