WormMine: Gene WBGene00034710

• WormBase Gene ID: WBGene00034710
• Gene Name: Cbr-lsy-2
• Sequence Name: CBG14093
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans lsy-2. In C. elegans, lsy-2 is involved in nematode larval development; neuron fate specification; and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14093b.1	CBG14093b.1		[unknown]
Transcript:CBG14093a.2	CBG14093a.2		[unknown]
Transcript:CBG14093a.3	CBG14093a.3		[unknown]
Transcript:CBG14093a.1	CBG14093a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14093b	CBG14093b		[unknown]
CDS:CBG14093a	CBG14093a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059009
• Remark: Cbr-lsy-2, AGCTACAATCAACACATGGAGTACCATGCCAAAGTCGCCAACCTTATTGACACTGGAGCA, WBGene00034710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term