WormMine: Gene WBGene00086898

• WormBase Gene ID: WBGene00086898
• Gene Name: CBG25484
• Sequence Name: CBG25484
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF38, Caenorhabditis species; F-box A protein FB155/FB224; and FTH domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25484.1	CBG25484.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25484	CBG25484		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065325
• Remark: CBG13419, GAGAAGATTTTGAATTGGAAAGCTTTTGGTATTTTGGGATTCCTGACGATTTGGAGAATG, WBGene00034189
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term