WormMine: Gene WBGene00035594

• WormBase Gene ID: WBGene00035594
• Gene Name: Cbr-unc-45
• Sequence Name: CBG15283
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; Myosin-binding striated muscle assembly central; UNC-45/Cro1/She4, central domain; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans unc-45. In C. elegans, unc-45 is involved in several processes, including chaperone-mediated protein folding; egg-laying behavior; and sarcomere organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15283.1	CBG15283.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15283	CBG15283		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1061786
• Remark: Cbr-unc-45, TTTCTAGAACTTCCGCTGCTGGATTCGCTATCTTAACAGAAGACGAAAATGCGTGTAGCA, WBGene00035594
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term