WormMine: Gene WBGene00085070

• WormBase Gene ID: WBGene00085070
• Gene Name: Cre-mig-32
• Sequence Name: CRE15551
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type and Zinc finger, C3HC4 type (RING finger). Is an ortholog of C. elegans mig-32. In C. elegans, mig-32 is involved in several processes, including negative regulation of vulval development; nematode male tail tip morphogenesis; and regulation of axon extension involved in axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15551.1	CRE15551.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15551	CRE15551		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113121
• Remark: Cre-mig-32, CCATTAGAAAGGCCTCGATTTTCACATCATCGTGATGATTGCCAAGTGACTGTAAATCTT, WBGene00085070
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term