WormMine: Gene WBGene00176354

• WormBase Gene ID: WBGene00176354
• Gene Name: CJA20782
• Sequence Name: CJA20782
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein OS9-like domain; Glucosidase II beta subunit-like protein; and Mannose-6-phosphate receptor binding domain superfamily. Is an ortholog of C. elegans F48E8.4 and Y105E8A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA20782.1	CJA20782.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA20782	CJA20782		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075416
• Remark: CJA20782, TAATATAGAAGACGAGAATCGAGCCTACTTGTGGTACTATTTCAATGATCCAACGTGGCC, WBGene00176354
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term