WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034991 Gene Name  Cbr-dnj-14
Sequence Name  ? CBG14527 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Chaperone J-domain superfamily and DnaJ domain. Is an ortholog of C. elegans dnj-14. In C. elegans, dnj-14 is involved in determination of adult lifespan; locomotion; and neurotransmitter secretion. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14527b.1 CBG14527b.1   [unknown]
Transcript:CBG14527a.1 CBG14527a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14527b CBG14527b   [unknown]
CDS:CBG14527a CBG14527a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dnj-14, TCAACTATGCGAACGCAGTGCTCTCGAATCCGAATAAACGAAAGGTTTACGATGAGATGG, WBGene00034991   Expr1067648 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term