WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032910 Gene Name  CBG11868
Sequence Name  ? CBG11868 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold and Armadillo-like helical. Is an ortholog of C. elegans T28F4.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11868.1 CBG11868.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11868 CBG11868   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG11870, TAAATGGGCGGAGCTTGCACACATTGCTACCAGTGGCTCTAGCAACGAATGCACATCCAA, WBGene00032912   Expr1070098 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG11868, AGAAATCCGCGTCGCGACGTGTCGATTAATCGGAAATTTGTGCAATAATAAGGAGCTGGG, WBGene00032910   Expr1064959 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term