WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00087811 Gene Name  CBG26397
Sequence Name  ? CBG26397 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Uncharacterised protein family UPF0390 and Protein of unknown function (DUF2462). Is an ortholog of C. elegans K07F5.15. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG26397.1 CBG26397.1   [unknown]
Transcript:CBG26397.2 CBG26397.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG26397 CBG26397   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG26397, ACAAAGATCATTAACGACAAGAACGAAGAGATGGTGAAGGGACGTGCCGATACCGCTGTT, WBGene00087811   Expr1067065 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term