WormMine: Gene WBGene00037539

• WormBase Gene ID: WBGene00037539
• Gene Name: Cbr-pan-1
• Sequence Name: CBG18042
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: BspA type Leucine rich repeat region (6 copies); Leucine-rich repeat; Leucine-rich repeat, typical subtype; BspA type Leucine rich repeat region; Leucine rich repeat; and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans pan-1. In C. elegans, pan-1 is involved in germ cell development and molting cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18042.1	CBG18042.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18042	CBG18042		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068584
• Remark: Cbr-pan-1, CAAGATGCGTTACTTGTATCGTGGAGCTTTCGATTCATTTGAACCAACTTCAATGGAAGC, WBGene00037539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term