WormMine: Gene WBGene00087067

• WormBase Gene ID: WBGene00087067
• Gene Name: CBG25653
• Sequence Name: CBG25653
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Caenorhabditis protein of unknown function, DUF282 and Protein of unknown function DUF282, Caenorhabditis species. Is an ortholog of C. elegans C04G6.2 and K02E2.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG25653.1	CBG25653.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG25653	CBG25653		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058851
• Remark: CBG25653, CTGATCATTGTTATATACTTTTCAATGATTAAAGTCTTGAATTCTTGTATTCCGACGCAG, WBGene00087067
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term