WormMine: Gene WBGene00038264

• WormBase Gene ID: WBGene00038264
• Gene Name: CBG18972
• Sequence Name: CBG18972
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF268, Caenorhabditis species and Caenorhabditis protein of unknown function, DUF268. Is an ortholog of C. elegans K04A8.1. In C. elegans, K04A8.1 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18972.1	CBG18972.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18972	CBG18972		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054941
• Remark: CBG18972, TTGCAATGATGTTCTACGGATATGAGTGGCTTGGAACATTTTCTGGAAATACTGAGCAAC, WBGene00038264
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term