WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027155 Gene Name  Cbr-syd-2
Sequence Name  ? CBG04493 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Sterile alpha motif domain; Liprin-alpha; Sterile alpha motif/pointed domain superfamily; LAR-interacting protein, Liprin; and SAM domain (Sterile alpha motif). Is an ortholog of C. elegans syd-2. In C. elegans, syd-2 is involved in several processes, including anterograde synaptic vesicle transport; egg-laying behavior; and positive regulation of anterograde synaptic vesicle transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04493.1 CBG04493.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04493 CBG04493   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-syd-2, AAGAAATCTGGTTGATAGCGGAATACACGGAGCGCTGATAGCCTTGGATGAAACTTTTGA, WBGene00027155   Expr1066363 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term