WormMine: Gene WBGene00038383

• WormBase Gene ID: WBGene00038383
• Gene Name: Cbr-hpo-9
• Sequence Name: CBG19111
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: F5/8 type C domain; BTB/POZ domain; SKP1/BTB/POZ domain superfamily; Coagulation factor 5/8 C-terminal domain; Galactose-binding-like domain superfamily; BTB/Kelch-associated; and BTB And C-terminal Kelch. Is an ortholog of C. elegans hpo-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19111.1	CBG19111.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19111	CBG19111		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065350
• Remark: CBG19111, ATCAACGAAGTCTTCCATGTTGTACATCTAGAAGCCCCTTCAAATGTTCCAATCGCCATA, WBGene00038383
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term