WormMine: Gene WBGene00024676

• WormBase Gene ID: WBGene00024676
• Gene Name: CBG01435
• Sequence Name: CBG01435
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Optic atrophy 3 protein (OPA3) and Optic atrophy 3-like. Is an ortholog of C. elegans H43I07.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01435c.1	CBG01435c.1		[unknown]
Transcript:CBG01435c.2	CBG01435c.2		[unknown]
Transcript:CBG01435b.1	CBG01435b.1		[unknown]
Transcript:CBG01435a.1	CBG01435a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01435c	CBG01435c		[unknown]
CDS:CBG01435b	CBG01435b		[unknown]
CDS:CBG01435a	CBG01435a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053299
• Remark: CBG01435, TGCCAGCTATTACTTCTACACGAAGCTAACGACGCCAGAATCGCTGAAAATCGAGGAGTA, WBGene00024676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term