WormMine: Gene WBGene00030105

• WormBase Gene ID: WBGene00030105
• Gene Name: CBG08286
• Sequence Name: CBG08286
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: ShK domain-like and ShKT domain. Is an ortholog of C. elegans K09B3.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08286b.1	CBG08286b.1		[unknown]
Transcript:CBG08286a.1	CBG08286a.1		[unknown]
Transcript:CBG08286d.1	CBG08286d.1		[unknown]
Transcript:CBG08286c.1	CBG08286c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08286a	CBG08286a		[unknown]
CDS:CBG08286c	CBG08286c		[unknown]
CDS:CBG08286b	CBG08286b		[unknown]
CDS:CBG08286d	CBG08286d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063979
• Remark: CBG08286, CTCGGCGGATTAGACCAGTATCCGCTGTCACAGTTCATCGGTAGATCTATTTATGAAACT, WBGene00030105
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term