WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023627 Gene Name  Cbr-tmbi-4
Sequence Name  ? CBG00173 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Inhibitor of apoptosis-promoting Bax1 and Bax inhibitor 1-related. Is an ortholog of C. elegans tmbi-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00173.1 CBG00173.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00173 CBG00173   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00177, TTCACCATCGGAATCTGTGTTGCCATTTACCATATTCCAAATTCCAAGACTTTTCTTCAA, WBGene00023629   Expr1069533 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-tmbi-4, TTGGATGTTCTCAACCTCTTCATCCGTATCCTCCAAATTGTTGCCGAGGCTAACAAGTAA, WBGene00023627   Expr1061982 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term