WormMine: Gene WBGene00120092

• WormBase Gene ID: WBGene00120092
• Gene Name: Cjp-ran-3
• Sequence Name: CJA00888
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Regulator of chromosome condensation (RCC1) repeat; Regulator of chromosome condensation, RCC1; and Regulator of chromosome condensation 1/beta-lactamase-inhibitor protein II. Is an ortholog of C. elegans ran-3. In C. elegans, ran-3 is involved in embryo development and positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00888.1	CJA00888.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00888	CJA00888		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089740
• Remark: Cjp-ran-3, TTTTCCATTATCGGAGCCTCTATTTCCGATCAGCACACTCTAATCCTGGCCAAAAAGAAC, WBGene00120092
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term