WormMine: Gene WBGene00030376

• WormBase Gene ID: WBGene00030376
• Gene Name: Cbr-che-7
• Sequence Name: CBG08617
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Innexin. Is an ortholog of C. elegans che-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08617a.1	CBG08617a.1		[unknown]
Transcript:CBG08617c.1	CBG08617c.1		[unknown]
Transcript:CBG08617b.1	CBG08617b.1		[unknown]
Transcript:CBG08617d.1	CBG08617d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08617c	CBG08617c		[unknown]
CDS:CBG08617b	CBG08617b		[unknown]
CDS:CBG08617a	CBG08617a		[unknown]
CDS:CBG08617d	CBG08617d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056842
• Remark: Cbr-inx-4, CCCCGTCGAACAGTGGTCACAATAAACTCTCAACAAAACGATGCACGTACAAGTCCGGAT, WBGene00030376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term