WormMine: Gene WBGene00030446

• WormBase Gene ID: WBGene00030446
• Gene Name: CBG08699
• Sequence Name: CBG08699
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF1096 and Protein of unknown function (DUF1096). Is an ortholog of C. elegans abu-7 and abu-8. In C. elegans, abu-7 is involved in pharynx development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08699b.1	CBG08699b.1		[unknown]
Transcript:CBG08699a.1	CBG08699a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08699a	CBG08699a		[unknown]
CDS:CBG08699b	CBG08699b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053702
• Remark: Cbr-abu-8, CAGATGTACAACCCATATAATAACAACAACCAGAACGCCAACTGCGCCCCAGCCTGCCAG, WBGene00030446
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term