WormMine: Gene WBGene00210074

• WormBase Gene ID: WBGene00210074
• Gene Name: CJA34227
• Sequence Name: CJA34227
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans bbs-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA34227a.1	CJA34227a.1		[unknown]
Transcript:CJA34227b.1	CJA34227b.1		[unknown]
Transcript:CJA34227e.1	CJA34227e.1		[unknown]
Transcript:CJA34227c.1	CJA34227c.1		[unknown]
Transcript:CJA34227d.1	CJA34227d.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA34227e	CJA34227e		[unknown]
CDS:CJA34227d	CJA34227d		[unknown]
CDS:CJA34227c	CJA34227c		[unknown]
CDS:CJA34227b	CJA34227b		[unknown]
CDS:CJA34227a	CJA34227a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092065
• Remark: CJA19013, GAAAGATTTCAGCTCTTCTTGGAAAGCTCTCAGCATCTACAAAGAGCTTCAGTCGGCGGG, WBGene00138217
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term