WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030509 Gene Name  Cbr-sumv-2
Sequence Name  ? CBG08774 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: KAT8 regulatory NSL complex subunit 3/Testis-expressed sequence 30 protein. Is an ortholog of C. elegans sumv-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08774a.1 CBG08774a.1   [unknown]
Transcript:CBG08774c.1 CBG08774c.1   [unknown]
Transcript:CBG08774b.1 CBG08774b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08774a CBG08774a   [unknown]
CDS:CBG08774b CBG08774b   [unknown]
CDS:CBG08774c CBG08774c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08774, TGAGCTCAACAATATTTTCGAGCTGGATTCATCTTTTCTGAAAGGGGATAAAGGACTCTC, WBGene00030509   Expr1059282 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term